vendredi 24 mai 2013

Protocole Purification de protéines avec un Tag GST.


Tampons :

Resuspension / binding buffer :                                              lysis buffer :                                      Cleavage buffer :
- 50 mM Tris pH7.5                                                         - 50 mM Tris pH7.5                         - 50 mM Tris pH7
- 500mM NaCl                                                                 - 500 mM NaCl                                 - 150 mM NaCl
- 1mM DTT                                                                        - 1% triton X100                               - 1mM DTT
                                                                                              - 1 mM DTT                                        - 1 mM EDTA
                                                                                              - 1 mM PMSF
                                                                                              - 5 mM Benzamidine

Production :
1.       Faire une préculture de 60ml ( compter 10ml de 2YT par erlen de 1L )
2.       Le lendemain, inoculer les cultures avec 10ml et faire pousser à 37°C jusqu’à DO 0.6
3.       Faire descendre la température des erlens à 16°C en les mettant dans la glace, environ 1h
4.       Induire avec de l’IPTG 0.5M, concentration finale 0.5mM IPTG
5.       Faire pousser O/N à 37°C:
6.       Centrifuger 1L de culture dans les grands pots à 5000g pendant 10min, en utilisant le rotor adapté.
7.       Resuspendre avec 100 ml de buffer resuspension
8.       Pooler la solution bactérienne concentrée dans un tube de 500 ml
9.       Centrifuger à 4°C 10 min à 5000g
10.   Eliminer le surnageant
11.   Congeler dans l’azote liquide
Purification :
1.       Incuber 5 ml de billes GSH sepharose pendant 20 min à 4°C avec 50 ml de lysis buffer
2.       Resuspendre le culot dans 100 ml de lysis buffer ( garder 2 µl pour un gel SDS, Extrait brute )
3.       Incuber avec un barreau aimanté pour homogénéiser la solution bactérienne concentrée.
4.       Soniquer 6 X 30 sec avec 30s – 1 min de pause entre chaque cycle ( maintenir la solution à froid )
5.       Clarifier le lysat en centrifugeant 30 min à 15000g ( rotor JA-17)
6.       Prendre 2 µl de surnageant pour un gel SDS, S = soluble
7.       Prendre 2 µl de surnageant pour un gel SDS, I = insoluble
8.       Répartir les billes incubées avec le tampon de lyse dans des tubes corning en fonction du volume de lysat clarifié.
9.       Incuber 2 h à 4°C sur une roue.
10.   Centrifuger le(s) tubes corning 10 min à 5000g 4°C
11.   Eliminer le surnageant ( garder 2 µl pour un gel SDS, NL = non lié avant coupure )
12.   Prendre 2 µl de billes pour un gel SDS, L = lié avant coupure
13.   Resuspendre les billes dans le tampon de binding en poolant dans 1 tube corning de 50 ml
14.   Laver 3 X avec du tampon de binding en centrifugeant 7min 5000g à 4°C
15.   Transférer les billes dans un tube de 15 ml
16.   Laver 3 X avec du tampon de clivage en centrifugeant 7min 5000g à 4°C
17.   Reprendre les billes dans 1V de billes avec le tampon de clivage
18.   Ajouter 160 µl de Precission
19.   Incuber O/N à 4°C sur une roue
20.   Centrifuger 10 min à 5000g 4°C
21.   Prendre 2 µl de billes pour un gel SDS, L = lié après coupure
22.   Prendre 2 µl de surnageant pour un gel SDS, NL = non lié après coupure = Protéine purifiée

mercredi 17 avril 2013

système pET

Fonctionnement du système pET avec la casette DE3 et le pLysS
cliquez ici

lundi 25 février 2013

Expression de proteine dans le periplasme bactérien

Pré séquence Dsb :
atg aag aaa atc tgg ctg gcc ctg gca ggc ctg gtt ctg gct ttc agc gct tcc gct

Site Nde1 :
CATATG

Site Eco R1 :
GAATTC

Site Not 1 :
GCGGCCGC



Séquence 8F1 N497Q & R503K

CATATG atg aag aaa atc tgg ctg gcc ctg gca ggc ctg gtt ctg gct ttc agc gct tcc gct GAATTC gat cag tgc att gtt gat gac atc act tac aat gtg cag gac aca ttc cac aag aag cat gaa gag ggg cac atg ctg aac tgt aca tgc ttc ggt cag ggt cgg ggc aag tgg aag tgt gat ccc gtc CACCACCATCATCACCATCAT CAC CAT CAC CAT CAC TGA GCGGCCGC


Séquence 9F1

CATATG atg aag aaa atc tgg ctg gcc ctg gca ggc ctg gtt ctg gct ttc agc gct tcc gct GAATTC gac caa tgc cag gat tca gag act ggg acg ttt tat caa att gga gat tca tgg gag aag tat gtg cat ggt gtc aga tac cag tgc tac tgc tat ggc cgt ggc att ggg gag tgg cat tgc caa cct tta cag acc tat cca agc tca CACCACCATCATCACCATCAT CAC CAT CAC CAT CAC TGA GCGGCCGC


Periplasmic localization
An alternative strategy to obtain active, soluble proteins is to use vectors that enable export into the periplasm, which is a more favorable environment for folding and disulfide bond formation (Rietsch et al., 1996; Raina and Missiakas, 1997; Sone et al., 1997). For this purpose vectors carrying signal peptides are used, such as pET-12, 20, 22, 25, 26, 27, 36, 37, 38, 39 and 40. Target proteins exported to the periplasm with the CBDcenA signal sequence may leak to the medium for simplified purification (Novy et al., 1997). However, some target proteins will not be good candidates for periplasmic localization. For example, some fusions of b -gal to a periplasmic protein have proven to be toxic (Snyder and Silhavy, 1995). In addition, the net charge of the Nterminal amino acids on the mature protein can inhibit translocation (Kajava et al., 2000) While several pET vectors contain signal sequences for fusion with target genes, pET-39b(+) and pET-40b(+) are designed to create fusions to the enzymes that catalyze the formation (DsbA) or isomerization (DsbC) of disulfide bonds in the periplasm (Missiakas et al., 1994; Zapun et al.,1995). If a fusion protein is competent to localize to the periplasm, then its direct association with the catalytic enzyme may enhance its solubility and facilitate disulfide bond formation. A properly folded fusion protein requiring formation of disulfide bonds for activity has been isolated following fusion to DsbA (Collins-Racie et al., 1995). Note that over-expressed, purified DsbC enzyme is isolated in the oxidized state and requires exposure to a reducing agent (0.1 to 1.0 mM DTT) to acquire disulfide isomerase activity in vitro (Joly and Swartz, 1997). Typically, a DsbC fusion protein expressed from pET-40b(+) is first purified by His•Bind® or Ni-NTA His•Bind chromatography. Prior to exposing the fusion protein to a reducing agent, either EDTA should be added to a final concentration of 1 mM, or the sample should be dialyzed to remove residual Ni2+. EDTA and dialysis is probably unnecessary if Ni-NTA His•Bind resin was used for purification.