PCR SOEing (synthesis by overlap extension)

PCR SOEing (synthesis by overlap extension)

This PCR based protocol is designed to attach two separate PCR products together that have been designed to have a short overlap of complementary sequence (typically 30 – 60 bp).  This overlap can be produced by the addition of bases to the ends of the internal primers for the respective PCR products.

For example:

                                   

5’ TGTAATTTCGTTTTATGCGCAGTTTTGGCTAGCCTGACACTTATCGGCTTTATCTGCTTA 3’

3’ ACATTAAAGCAAAATACGCGTCAAAACCGATCGGACTGTGAATAGCCGAAATAGACGAAT 5’

The red sequences are essentially the sequences of your forward and reverse primers for the separate PCR products.

1.) The first order of business is to amplify the separate PCR products to be combined and purify them following agarose gel electrophoresis.

2.) Generic SOE PCR

Need to make up two separate master mixes called A and B and store on ice.

                                                  Master mix A                        Master mix B

5X Phusion Buffer                           5.0 ul                                   5.0 ul

2.5 mM dNTPs                                2.0 ul                                    2.0 ul                   

Phusion polymerase                        .25 ul                                    .25 ul

10uM External Fwd Primer               0 ul                                    5.0 ul

10uM External Rvs Primer                0 ul                                    5.0 ul

Sterile milli-Q                             12.75 ul                                  7.75 ul 

Total                                              20.0 ul                                  25.0 ul

1.      Prepare DNA templates.  Assuming a relatively successful PCR for each of the two PCR products, I add around 1 ul of each template to a PCR tube.  If one PCR product was in lesser amount, I will compensate by adding another 1-2 ul of it.  Then add sterile milli-Q to achieve a total volume of 5 ul for each SOE reaction.  Set up a similar reaction but with the PCR products diluted ten-fold (for example add 45 ul of sterile milli-Q to a similar 5 ul of combined templates.

2.      Add 20 ul of Master Mix A to 5 ul volume of combined PCR templates and run these 25 ul reactions for the first 10 cycles (Maker a program called something like SOE PCR) in a PCR SOEing program. 

             SOE PCR (a typical program for a desired product less than 2 kb in size)

             1.  94^oC for 5 minutes.

             2.  94^oCfor 30 seconds

             3.  60^oC for 1.5 minutes

             4.  72^oC for 2.5 minutes

             5.  Repeat steps 2-4 ten times.

             6.  Hold at 10 ^oC for ten minutes (window of time to add mix B)

             7.  94 ^oC for 30 seconds

             8.  58 ^oC for 30 seconds

             9.  72 ^oC for 2 minutes

             10.  Repeat steps 7-9 thirty five times

             11.  Hold at 72 ^oC for 10 minutes

             12.  Hold at 10 ^oC indefinitely.

3.      After 10 cycles, add 25 ul of Master Mix B to the appropriate tubes.  Mix B includes the external primers that are needed to initiate the exponential increase of the SOE PCR product. 

4.      Run SOE PCRs on a preparative gel to isolate the product running at the expected size for the combination of the individual pieces.