atg aag aaa atc tgg ctg gcc ctg gca ggc ctg gtt ctg gct ttc agc gct tcc gct
Site Nde1 :
CATATG
Site Eco R1 :
GAATTC
Site Not 1 :
GCGGCCGC
Séquence 8F1 N497Q & R503K
CATATG atg aag aaa atc tgg ctg gcc ctg gca ggc ctg gtt ctg gct ttc agc gct tcc gct GAATTC gat
cag tgc att gtt gat gac atc act tac aat gtg cag gac aca ttc cac aag aag
cat gaa gag ggg cac atg ctg aac tgt aca tgc ttc ggt cag ggt cgg ggc aag
tgg aag tgt gat ccc gtc CACCACCATCATCACCATCAT CAC CAT CAC CAT CAC TGA GCGGCCGC
Séquence 9F1
CATATG atg aag aaa atc tgg ctg gcc ctg gca ggc ctg gtt ctg gct ttc agc gct tcc gct GAATTC gac
caa tgc cag gat tca gag act ggg acg ttt tat caa att gga gat tca tgg gag
aag tat gtg cat ggt gtc aga tac cag tgc tac tgc tat ggc cgt ggc att ggg
gag tgg cat tgc caa cct tta cag acc tat cca agc tca CACCACCATCATCACCATCAT CAC CAT CAC CAT CAC TGA GCGGCCGC
Periplasmic localization
An alternative strategy to obtain active, soluble proteins is to use vectors that enable export into the periplasm, which is a more favorable environment for folding and disulfide bond formation (Rietsch et al., 1996; Raina and Missiakas, 1997; Sone et al., 1997). For this purpose vectors carrying signal peptides are used, such as pET-12, 20, 22, 25, 26, 27, 36, 37, 38, 39 and 40. Target proteins exported to the periplasm with the CBDcenA signal sequence may leak to the medium for simplified purification (Novy et al., 1997). However, some target proteins will not be good candidates for periplasmic localization. For example, some fusions of b -gal to a periplasmic protein have proven to be toxic (Snyder and Silhavy, 1995). In addition, the net charge of the Nterminal amino acids on the mature protein can inhibit translocation (Kajava et al., 2000) While several pET vectors contain signal sequences for fusion with target genes, pET-39b(+) and pET-40b(+) are designed to create fusions to the enzymes that catalyze the formation (DsbA) or isomerization (DsbC) of disulfide bonds in the periplasm (Missiakas et al., 1994; Zapun et al.,1995). If a fusion protein is competent to localize to the periplasm, then its direct association with the catalytic enzyme may enhance its solubility and facilitate disulfide bond formation. A properly folded fusion protein requiring formation of disulfide bonds for activity has been isolated following fusion to DsbA (Collins-Racie et al., 1995). Note that over-expressed, purified DsbC enzyme is isolated in the oxidized state and requires exposure to a reducing agent (0.1 to 1.0 mM DTT) to acquire disulfide isomerase activity in vitro (Joly and Swartz, 1997). Typically, a DsbC fusion protein expressed from pET-40b(+) is first purified by His•Bind® or Ni-NTA His•Bind chromatography. Prior to exposing the fusion protein to a reducing agent, either EDTA should be added to a final concentration of 1 mM, or the sample should be dialyzed to remove residual Ni2+. EDTA and dialysis is probably unnecessary if Ni-NTA His•Bind resin was used for purification.
